Foon → Ludum Dare Explorer → Users → Josh @ Dreamland
| Year | LD | Theme | Game | Division | Rank | Ov | Fu | In | Th | Gr | Au | Hu | Mo | Cm | Co | ||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 2012 | 24 | Evolution | The SuperBugs | compo | 196 | 3.31 | 3.16 | 2.69 | 2.84 | 3.04 | 2.14 | 2.40 | 2.63 | 100 | |||
| 2011 | 22 | Alone | OH COME ON | compo | 580 | 2.13 | 2.06 | 2.13 | 2.44 | 1.50 | 1.11 | 3.14 | 1.57 | 2.33 | 36 | ||
| 2011 | 21 | Escape | Cave Escape | compo | 198 | 3.00 | 2.47 | 2.79 | 2.68 | 3.26 | 1.00 | 1.00 | 1.75 | 2 |
Josh @ Dreamland leaves an average of 38.0 feedback comments each event.
The concept is somewhat innovative. As you said, there wasn't enough visual feedback, and as has been said, the jumps and collisions are kind of frustrating. I am wondering if I've missed a wallkick or double jump mechanism, because it's easy to get stuck and screw yourself.
Points for fun, and points for innovation. Quite unique, just annoying in the collisions department.
Exception in thread "main" java.lang.UnsatisfiedLinkError: no lwjgl in java.library.path
at java.lang.ClassLoader.loadLibrary(ClassLoader.java:1681)
at java.lang.Runtime.loadLibrary0(Runtime.java:840)
at java.lang.System.loadLibrary(System.java:1047)
at org.lwjgl.Sys$1.run(Sys.java:73)
at java.security.AccessController.doPrivileged(Native Method)
at org.lwjgl.Sys.doLoadLibrary(Sys.java:66)
at org.lwjgl.Sys.loadLibrary(Sys.java:95)
at org.lwjgl.Sys.<clinit>(Sys.java:112)
at org.lwjgl.opengl.Display.<clinit>(Display.java:135)
at nl.sonware.alone.Alone.start(Alone.java:44)
at nl.sonware.alone.Alone.main(Alone.java:116)
You certainly have that professional touch.
It is impossible to be mad at the game play, because the only person you have to be mad at is yourself for choosing the path that collided. Took me some 30 tries to beat this.
Points for mood, audio, and graphics. The game was kind of fun until there were so many crowds I couldn't walk 32 pixels.
I'm a little pissed you went and beat me. Still, great little game.
Your game is fucking freaky, man. It may be the 1:30 AM thing, but this game is damned scary.
Indeed, I was sad to see that the game was so short. The graphics are eye-catching; I love the style.
Other remarks: Fucking birds.
Decent graphics, good sound, but the engine was bad. Allow resuming at a level with a score detriment or fix the bounding boxes, because I don't find it at all fun trying to get up that skinny level with all the falling lava when I keep hitting my head on my way out, then end up trapped on the left where all the falling lava hurts you. I entered that level with 14 health the third time, and watched it all drain as lava I was in no way contacting (and was in fact, supposed to be safe from) hurt me.
A fun game. I like your deliberate misinterpretation of the contest theme; pretty funny. You seem to have gotten sick of making levels pretty quick there, which is odd considering how simple you made the level mechanism. Still, good game.
Very funny, very enjoyable game. The only thing I didn't like was not getting to see the room of evil. ;)
I found that the controls were very "sticky," to the point of being frustrating. This was a new level of sticky; 25% of the time, the player wouldn't even move while holding a button, which made beating it not even seem worth it, especially when you have to restart every time you're hit.
Wonderfully creative, with a great plot. The spriting was largely good (characters, mostly--the terrain was flat but did the trick for the time limit). Massive points for innovation.
Good concept, well executed. The graphics were simple, but you shaded the pixels to make it look deliberate, and that's pretty good. Waiting through the slides is a little annoying--I'd like to quickly gather the jist of what happens and move on. Other than that, pretty good.
I kept making very little progress, then getting stuck in walls. The game's main innovation was the color change, which would have helped me maintain a better idea of where I was if I didn't keep getting jammed into a wall. I gave up after the third time, stuck somewhere in green. :P
Try using bounding box collisions rather than pixel-perfect ones. Also, yes, the random level generator produces 75% unbeatable levels.
So I get to level 14, and with no end in sight, I decide that coin isn't worth it, and finish with a 7/8. Ugh.
Other than that, I like the slower pace puzzle feel. Some of the path finding made me feel like I didn't have a say in the move at all, but overall pretty good.
Yeah, I was sad at the length, but the engine is solid (which is more than I can say for what I scraped together) and the graphics are eye-catching. VDO and I seem to share an idea of what looks interesting.
Looks fun. Doesn't run in WINE; too lazy to compile as there is nothing that says Makefile. :P
Yes, the amount of monologue is very impressive. Made it to the teleporter room much sooner than I expected; figured I was lucky. Very nice game, overall.
LD24 — Evolution (92)
Besugo by fanatiko 2012-09-12T13:17:00
I hate it when there's no winning.
It'd help if you gave controls next time.
HumanTECH by minism 2012-09-11T19:45:00
Pretty great. Good graphics, good audio; sets the mood well. Great length for a Ludum Dare game, and it doesn't get boring, which is the neat part. Engine's solid, and the collisions are great. Can't say that for a whole lot of games this competition.
.ISO - Part One by Kortuga 2012-09-11T04:28:00
Graphics and audio are stunning. I have no idea what you did wrong with the engine, because it constantly thinks I'm holding the right key. Even when I don't touch it. It seemed to have that problem with a lot of keys, but right was the only one it would think I pressed without me ever touching it (while other keys would just stick). Probably Game Maker's fault, honestly, but it nonetheless prevented me from completing the first level with buzz saws.
Anyway, keep up with the art (graphics and music). I've never been that great at spriting, nor do I have any musical talent, and I knew very few people as good as you at it when I was 14.
As a matter of fact, your game is pretty solid for Game Maker in general; quite impressive for 48 hours. Even considering the parts of code from various contributors' repositories (eg, the text box script).
See the prior remarks on wall jump mechanics.
Other remarks: SWEET MOTHER OF GOD, THE SOURCE FILE IS A SINGLE, 170MB OBJECT. I told IsmAvatar not to preload sound data into the IDE, but nooooo, 17 months later it's still doing it. As said, don't use WAV for music. MP3 seems like your best bet, since you use GM (ours supports OGG and XM/S3M/IT), but WAV is not your friend. Also, avoid execute_string(), it's a bad habit (and it makes it so I can't compile the thing natively, which is annoying).
Not a bad shot.
Planet Evo by dick_claus 2012-09-11T03:36:00
What the first guy said.
DNADream by Zener 2012-09-11T03:24:00
Quite innovative. After a score of 5100 I had so much time left it wasn't a challenge anymore, but the concept was still neat.
Kitten Evolution by AngelDE98 2012-09-11T03:13:00
Good graphics and audio. Freezes on level 2 loading screen and commences filling RAM, never to complete.
Empire of the Petri Dish by quadtree 2012-09-10T02:23:00
Sudden audio scared the hell out of me. Probably because it's late. Anyway, I had no idea what I was doing, but it looked really cool, doing it.
UNBOUND by LPGhatguy 2012-09-10T01:57:00
Points for mood. Evolution was very subtle--a bit too artistically abstract for my taste, but the mood really helped it. Now, a question: Why did you feel the need to hijack my cursor and replace it with a pointer sixteen times as sensitive?
The Destiny of Species by kurrik 2012-09-10T01:37:00
Yeah, I lack WINE64, so I can't play this either.
Infect by Timster Studios 2012-09-10T01:35:00
So this is the umpteenth bottom-of-my-barrel game I can't play because it needs XNA, and WINE doesn't do XNA. Screenshots were very alluring to me, too.
Unnatural Selection by SaiKai 2012-09-09T17:25:00
WINE doesn't like XNA at all, so my list is pretty much nothing but XNA games I can't run, at this point.
UPix by Xaychru04 2012-09-09T17:25:00
WINE doesn't like XNA at all, so my list is pretty much nothing but XNA games I can't run, at this point.
The World of Worlds by 2A1S 2012-09-09T17:24:00
I've never had a good experience with XNA. And WINE doesn't like XNA at all, so my list is pretty much nothing but XNA games I can't run, at this point.
Unnatural Selection by goffmog 2012-09-09T17:21:00
Can you build a Windows binary? WINE won't help me run this in the browser.
Slime Slayer by Mjiig 2012-09-09T17:19:00
I installed everything libjpeg-related that was available, but this still won't run for me on Ubuntu 12.04. I have the development packages, too.
Apes vs Dinosaurs: Unnatural Selection by Vilborg 2012-09-09T17:16:00
XNA and WINE just don't agree; an installer won't help.
#1 Bacterial Color Evolution - Bioterrorism against your browser! by bayesian 2012-09-09T13:56:00
Controls? I see you click to push particles. My goal is to make everything pink by some magic, without an understanding of what is happening. Pushing them together did nothing; all I was seeing was a number near thirty fluctuate within 1%.
DNA Soup by Prealpha 2012-09-09T13:50:00
DNA speed reaches a point where the game plays itself, but you still lose because there's just no winning. Pretty neat idea, pretty fun.
The Horrifying and Viciously Aggresive Though Strangely Susceptible To Evolution Monsters From Some Mysterious Random Tomb by Ret44 2012-09-09T13:19:00
I must be at the bottom of the bucket, because all the games I've clicked today have been XNA, and I can't run them.
Experiment X by XmmmX 2012-09-09T13:18:00
Yeah, XNA and WINE don't get along, either.
Exvolvere by AnnoMundi 2012-09-09T04:51:00
Representing four players at once without a graphical interface was a bit much. Neat idea, but it kind of fell through for me.
Gregor the Grogre by Glamdring 2012-09-08T18:23:00
Can you build this natively? WINE can't help me run Unity in a browser.
On the Origin of Block by savethejets1 2012-09-08T17:56:00
Very cool. Good music. Graphics weren't great, but they worked. Very unique idea; quite fun. Controls and jump heights could have used explanation.
Pixels through time by Arsenio117 2012-09-08T17:19:00
Failed to start.
Exception in thread "main" java.lang.reflect.InvocationTargetException
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:616)
at org.eclipse.jdt.internal.jarinjarloader.JarRsrcLoader.main(JarRsrcLoader.java:58)
Caused by: java.lang.Error: Unresolved compilation problems:
g cannot be resolved to a variable
Syntax error, insert "}" to complete Block
at pixels.ac.<init>(ac.java:25)
at pixels.ab.<init>(ab.java:11)
at pixels.aa.main(aa.java:11)
Primordial Guard by CogComp 2012-09-08T17:00:00
XNA/family choke WINE.
You Made them! by garygreen 2012-09-08T14:00:00
I'm gonna join in complaining about how there's no feedback. I had no idea what I was doing, until it told me that I hadn't gotten far enough for them to exist. It's neat that you made it in Scratch, because my general feeling about Scratch is that it is incapable of producing a game. I like the idea, I just didn't see it in the game.
EvoBlob by Tritax 2012-09-08T13:47:00
Unfortunately, the game makes WINE explode. Re-scanning the description, I realize it's because it's XNA.
eukaryotic. by pinkmonkeyhead 2012-09-07T21:50:00
Intro is amazing. Sound is great for LD, graphics are really good. Gameplay is frustrating; five health that never recovers, and insufficient funds to even begin generating funds make it a pain. I don't think it's possible to attain what you show in the screenshots without cheating.
Dorobou Neko! by pythong 2012-09-07T21:22:00
Not seeing any evolution whatsoever, but since I don't see any rules that disqualify games that don't follow themes, so I'll still rate it. The kittens are annoying; had I not beaten level ten on the first try I'd have given up. Also, the bridges don't work. That aside, the game mechanics were pretty fun and interesting.
Neurochronic Alien Fighter: Evolution! by Ken Reismann 2012-09-07T20:34:00
main.py:316: SyntaxWarning: name 'objects' is used prior to global declaration
global objects
main.py:359: SyntaxWarning: name 'score' is assigned to before global declaration
An Astronomical Affray by reheated 2012-09-07T20:30:00
Can't run because WINE can't put things in the MATE system tray. Don't know why this needs an icon in my tray, but...
Shapelution by TuxedoFish 2012-09-07T20:28:00
Okay, really, this is the third Java 7 game I've seen. Why can't people just use Java 6 for a bit longer while 7 spreads?
Bomb the Bunnies by Sestren 2012-09-07T20:26:00
Reminds me vaguely of circle the cat. Kind of fun until you win a few times.
Missing Links by Spelchan 2012-09-07T18:49:00
Collisions are wildly annoying. Graphics are a little hodgepodge, but I like the background texture. Theme's okay, a bit too historic for my tastes, but I'll count it. Audio's really loud.
RGB Evolution by crossin 2012-09-07T18:08:00
This game is much more fun than it really ought to be. You're one of the few who took the theme to heart and really sewed in the evolution aspect. That said, you're one of the many who don't know how to say, "You Win!" I bred an invincible super-army for size, and played to level 32 before realizing there was no winning. By that point, my army was bigger than the screen, and the enemy died nearly instantly. But I still didn't win.
Still, great use of theme. Good game.
Far From Earth by Ramikaze 2012-09-07T17:10:00
Could you build this with Java 6? My OS doesn't offer Java 7, or vice-versa.
The Room by CowboyDan 2012-09-07T17:02:00
Any chance of a Linux build?
A Caveman Goes to Space! by yajiv 2012-09-07T17:01:00
Is it just me, or has the number of XNA games tripled this time? I can't play these in WINE, unfortunately.
Cellulae by mariscal 2012-09-07T17:00:00
XNA never agrees with WINE...
Dragoneticist by Gidaio 2012-09-07T14:41:00
Full points for Innovation, Theme, and Graphics. Very creative; nice to see a game that actually came up with a creative twist on the theme.
If anyone wants the best string I came up with, it is this:
agggacttagctaggtttaaatgcgaacctaatcat
I can't tell if there are any more useful strands or not.
Also, yeah, kind of annoying entering them manually. Maybe with a keyboard, or clipboard function?
Anyway, nicely done.
Digital Evolution by TheJackiMonster by TheJackiMonster 2012-09-07T13:48:00
It was a fun game with great graphics, a solid engine, and decent audio, but literally nothing changed or evolved. There was just nothing new or theme-related here. Still, nice game, decently fun; I won't hold the theme against the overall category.
Glider Drop by tomhunt 2012-09-07T13:41:00
The controls were annoying, but I like the concept. Not all that evolution-y, but still better than the run-of-the-mill "collect powerups!" games I've been seeing. My only real complaint with the controls are that it resets your position each time; I want to be just a few pixels away from where I dropped last time, for massive damage.
Untitled Tower Game by chuchino 2012-09-07T03:53:00
The game lagged so much I didn't want to continue, unfortunately. Didn't hear any audio, but the graphics were great. I keep seeing all these games with powerups and abilities rather than actual evolution... sort of a pity. Engine was pretty solid, but the ability to slow down while jumping is a must.
Garbage Man: Return to Earth [HD] by nicholi 2012-09-07T03:40:00
WINE doesn't like it, apparently. Maybe because it's 64 bit?
T.R.E.E. by Fritzendugan 2012-09-07T03:36:00
I'm going to assume I'm not supposed to start out with no weapons and no ability to mine in the middle of a barrage of enemies I can't defend against.
Growth by Rellikiox 2012-09-07T03:27:00
Biggest peeve from this game is the random spawn; sometimes I spawn in the middle of 1,000 enemies, sometimes I spawn outside the level. Cleared the whole game (assuming there's no hidden exit to level five), wish there were an ending screen. I'd take an ending screen over a title screen with a "play" button any day.
Vegetal Evolution by Toastation 2012-09-07T03:03:00
Still not working on Linux, I'm afraid. Other people have gotten LWJGL games working great with a shell script; you might want to invest in that ;)
Survival of the Fittest by codesavage 2012-09-07T03:00:00
Very solid engine for HTML5, but the down slopes need work (can't jump on them while moving down). Great audio, great graphics, but I'm afraid there wasn't much else to this game at this point. Do continue it; it seems to be a nice foundation.
Temporal Agent by Deykoweec 2012-09-07T02:51:00
This is the second game I've seen exclusively for Android...
Out of the Sea by Uberi 2012-09-07T02:50:00
Space to evolve into a random animal doesn't fit the theme very well, but it is pretty funny.
Monsieur Evolution by monsieur_nez 2012-09-07T02:43:00
I can't run unity from the web, but I can through WINE if you build it for Windows.
Monkey Trial Turnaround by SusanTheCat 2012-09-02T15:34:00
I like your art style, and the idea is neat, but I am not personally a fan of this kind of game in general. The objection screen was funny. Audio was good, too.
Unstable Planet by HunLyxxod 2012-09-02T05:42:00
Impossible to lose, really; levels don't get any harder. Took me a while to realize they just go on to infinity. Still, procedural generation is neat. Graphics are lovely. Nicely done.
Squishy's escape by Beanalby 2012-09-02T04:42:00
A bit short, but the idea was there. It was very simple to figure everything out; a couple games with similar dynamics (ie, evolved abilities) benefited more from their perplexing level design than their graphics. Still, neat game.
The Fromagist by ABPositive03 2012-09-02T04:31:00
I got one of the beaver endings. I appreciated the unicorn and zombie endings. ;)
Evolution Jumper by UntitledQ 2012-09-01T22:22:00
Chokes WINE. I really should scan the description for Microsoft dependencies before I try running this stuff. >_<
Eludare Virus by Kendja 2012-09-01T22:18:00
It's interesting how much better a texture makes simple shapes look; the graphics appear professional with the light gradient and the rough texture. Not really all that fun, but kind of interesting.
Aggrandize by phaze0 2012-09-01T22:12:00
I suppose this means you can't just build for other platforms?
EvoCube: Epoch Victorious by kratorspore 2012-09-01T22:10:00
Great puzzle idea, and awesome graphics to boot. If you try hard enough, you can walk through walls. Took me a while to figure out what was going on, but I found it quite fun once I did. Beat it twice.
The Amazing Adventure of Magenta-Man by Doctor Broccoli 2012-09-01T21:12:00
Makes WINE explode. =\
Dragonkin EVO by bobiniki 2012-09-01T21:09:00
Unhandled Exception: System.TypeLoadException: Could not load type 'GB2Dsample.Game1' from assembly 'The Darwinizer, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null'.
Am I missing something?
Plan M by MurrayL 2012-09-01T21:06:00
My monitor doesn't support the resolution your game tries to impose. Or if it tries a number of resolutions, WINE just doesn't agree with it.
Cannibal Slugmage of Eden by triliyn 2012-09-01T21:03:00
This is experimental prerelease support for the Windows platform: use at your own risk. "Your Kitten of Death awaits!"
WARNING: Error calling finalizer #<CLOSURE (LAMBDA # :IN INITIALIZE-INSTANCE)
{22981085}>: #<SIMPLE-ERROR "EXCEPTION_ACCESS_VIOLATION" {24B6F3F1}>
VirtualAlloc: 0x1e7.
fatal error encountered in SBCL pid 55: handle_exception: VirtualAlloc failure
Welcome to LDB, a low-level debugger for the Lisp runtime environment.
The Darwinizer by Steven Colling 2012-09-01T21:01:00
XNA games don't agree with WINE.
SPECIES by alwaysinbeta 2012-09-01T20:59:00
I like the framerate. Unique for browser games. The rate at which one enemy could kill you was somewhat ridiculous, but the length of the game made up for it to a degree. Parts of it were very frustrating. Lots of points for humor; the mustache made it. The theme was very loosely tied in, though.
.Evolvorous. by repstyle 2012-09-01T20:39:00
Could you upload just a zip of the game contents? I'd rather not install it, especially through WINE.
Evolution game by tmt_01 2012-09-01T20:38:00
Unfortunately, .NET and WINE don't agree. Screenshots are very... interesting, though.
Stadium of the Kernel by jamiebell-oldtopman 2012-09-01T20:30:00
Fascinating; first ncurses game I've ever played from Ludum Dare. A bit hard to follow, though, and there's a huge curve between the fourth and fifth bosses. Either way, not bad.
Natural Selection: Travel Agency by lightspeedlucas 2012-09-01T20:07:00
Fails to run in WINE, unfortunately. Looked pretty cool.
Infestation by jwin 2012-09-01T20:01:00
Unity...
Vesuvius by Joker 2012-09-01T19:59:00
.......
A scientific experiment by sirGustav 2012-09-01T15:23:00
Fun, kind of funny game. It's amazing how simple graphics can look so elegant and endearing; they really looked nice together. Steep learning curve; after I figured out that I could aim upwards, the game became unlosable. Which was fine, because after like 30 waves, I could afford everything all at once, and so next round I went all Keanu-Reeves-Kitty on everyone. I'd let them all gang up on me, then BOEM, I go flying and they're all dead.
Quite enjoyed this game; wish there was a conclusion, because I ended up with nearly a hundred "children" and just wanted to be done.
Tonality by hgcummings 2012-09-01T14:13:00
Points for theme and innovation. Very clever. Real bacteria, though, have DNA much more similar; two randomly selected bacteria from the population have DNA that's nothing alike, which makes the game very hard, especially for people like me who have no musical talent. It'd be nice to win once in a while, is all I'm saying. ;)
"Natural" Selection by r4m0n 2012-09-01T14:06:00
The enemies "adapted" to spawning at the bottom of the screen where I can't hurt them without getting hurt. Still kind of neat; just not the challenge I was looking for.
Ascension Garden by sclark39 2012-09-01T00:13:00
Big fan of the idea. Implementation was a bit of a pain in the ass, but, meh, I like it anyway.
Pasazh by harusame 2012-08-31T23:52:00
Ran fine from Ubuntu. Can hardly believe this was made in two days. Fantastic graphics and level design; that alone would have taken me more than 48 hours. Music was nice. My score on the first round was 167; killed everything, but missed two crystals.
Lab Experiment Demo by Threef 2012-08-31T21:44:00
Fantastically done; your ideas were brilliantly creative. The raphics all worked well together, with exception of that one boulder sprite. The puzzles were great. Engine was mostly solid; a couple collision bugs made apparent in the portal reference. Remember to limit your vertical speed. Overall, very well done.
Game Time Evolution by Jacic 2012-08-31T21:03:00
I died 14 times; 11 were due to the jump bug, 2 were due to the lack of delay between respawn and death. One was because the enemies actually contacted me. I liked the theme; evolution of video games. The dialog was a bit cheesy, but overall nice.
Shit! It's evolving by fruitfly 2012-08-31T14:56:00
The audio is badly broken; play the no audio version if it gets stuck loading for you.
I gotta say, the dynamics are good, the collisions are good, the idea is good, but the controls are awful. A and D usually strafe, so you can keep aiming at what you're shooting at. Instead, I get eaten 10% of the time, which would be fine except you have to start all over. Overall, good game.
Evo by DaveDobson 2012-08-31T06:00:00
Great graphics, great introductory sequence, good puzzles. Funny use of unicorns. I didn't hear any sound; apparently that's some sort of glitch as they are mentioned in comments and in your description.
Monkeyectomy by iximeow 2012-08-31T03:17:00
It says "Press enter to continue", but Enter doesn't do anything.
kinetic dream by mdkess 2012-08-31T03:12:00
Very, very nice. Could have told me this was a Jam game and I'd believe you. The sounds, music, graphics... The graphics were very simple, yet being vector graphics/basic shapes made it look quite elegant. Plus, the motion and framerate were very smooth, which is a rarity in Ludum Dare games. Game play was nice, and mostly balanced; if anything, it was a bit too easy. Only complaint is that the sound sometimes got really loud as multiple sources played over each other. Great game, over all.
Darwin's Ghost vs. Science by zachstronaut 2012-08-31T02:53:00
Very polished; felt nothing like it had been made in 48 hours. My only complaint is that it was surprisingly short; it seems like you had everything down very well, and I was expecting to have a level wherein the switch-instead-of-push dynamic really became part of the puzzle. Either way, very nicely done.
Evowing by Cracky 2012-08-31T02:18:00
Great music, great graphics. Balance is all off. I spend $200 on blasters up front, and don't spend anything else, saving up for missiles before getting wiped out by the hyper-advanced weapons of the "evolved" enemies. Level one, I'm losing because everyone but me has a deflector.
EvolutionaryWeapon by Japskua 2012-08-31T01:54:00
Game looks really good; no one around here does XNA, though.
OS: Evolution by zatyka 2012-08-31T01:53:00
Try as I might, I can't beat this game. It just takes too many tries to get each jump right, and I keep falling through the floor. Seems to be a good number of levels. Wish I could see the ending. Overall, great work; just need more boost than the flamethrower actually gives to get through the level.
Involucion by elxris 2012-08-30T23:25:00
Can you build this for Java 6? I do not have Java 7, and it is not yet offered on my platform.
Lepidopter Attack by dwrensha 2012-08-30T23:19:00
I like the idea, but you didn't give it nearly enough room to take effect. Three generations isn't a whole lot of time for moths to evolve; I don't think I'd have centered the game around the idea without tripling the number of rooms.
Passive by Suffolk and Clever 2012-08-30T23:14:00
It seems a lot of work went into the graphics and audio. The collisions could use work; snagging on the bottom corner of a wall as you move diagonally is annoying. Overall I like the idea, though the theme was very loosely tied in, in my opinion.
Evoship by Punga 2012-08-30T23:04:00
The game could use some balance; after about 1000 health, the game becomes unlosable. I ended up having over 100,000,000 life. It was also very predictable; enemy types and boss scenes were random, but everything else was mathematically modeled and not well balanced.
In spite of that, the game was still fun, and quite addictive. How bad can it be if it kept me playing until I had stats that high?
Go Darwin by StabAlarash 2012-08-30T21:47:00
I laughed when that 800 pound pink dodo showed up. Great little game; great graphics, funny and well-thought theme. Really liked it.
Caveman Evolution Story by davidllanos22 2012-08-27T14:36:00
Nice game! The graphics all fit well together, the story's rather amusing; I like it. The spike collisions could be a bit more lenient. Other than that, I quite liked it.
By the way: When I play the web version, all that happens is the elderly man drops off the screen. And my browser lags.