Aphelion Incident by Cirrial 2011-08-22T05:04:00
Yes, the amount of monologue is very impressive. Made it to the teleporter room much sooner than I expected; figured I was lucky. Very nice game, overall.
Foon → Ludum Dare Explorer → Users → Josh @ Dreamland
| Year | LD | Theme | Game | Division | Rank | Ov | Fu | In | Th | Gr | Au | Hu | Mo | Cm | Co | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 2012 | 24 | Evolution | The SuperBugs | compo | 196 | 3.31 | 3.16 | 2.69 | 2.84 | 3.04 | 2.14 | 2.40 | 2.63 | 100 | ||
| 2011 | 22 | Alone | OH COME ON | compo | 580 | 2.13 | 2.06 | 2.13 | 2.44 | 1.50 | 1.11 | 3.14 | 1.57 | 2.33 | 36 | |
| 2011 | 21 | Escape | Cave Escape | compo | 198 | 3.00 | 2.47 | 2.79 | 2.68 | 3.26 | 1.00 | 1.00 | 1.75 | 2 |
Yes, the amount of monologue is very impressive. Made it to the teleporter room much sooner than I expected; figured I was lucky. Very nice game, overall.
Yeah, I was sad at the length, but the engine is solid (which is more than I can say for what I scraped together) and the graphics are eye-catching. VDO and I seem to share an idea of what looks interesting.
A fun game. I like your deliberate misinterpretation of the contest theme; pretty funny. You seem to have gotten sick of making levels pretty quick there, which is odd considering how simple you made the level mechanism. Still, good game.
Good concept, well executed. The graphics were simple, but you shaded the pixels to make it look deliberate, and that's pretty good. Waiting through the slides is a little annoying--I'd like to quickly gather the jist of what happens and move on. Other than that, pretty good.
Decent graphics, good sound, but the engine was bad. Allow resuming at a level with a score detriment or fix the bounding boxes, because I don't find it at all fun trying to get up that skinny level with all the falling lava when I keep hitting my head on my way out, then end up trapped on the left where all the falling lava hurts you. I entered that level with 14 health the third time, and watched it all drain as lava I was in no way contacting (and was in fact, supposed to be safe from) hurt me.
Wonderfully creative, with a great plot. The spriting was largely good (characters, mostly--the terrain was flat but did the trick for the time limit). Massive points for innovation.
Looks fun. Doesn't run in WINE; too lazy to compile as there is nothing that says Makefile. :P
So I get to level 14, and with no end in sight, I decide that coin isn't worth it, and finish with a 7/8. Ugh.
Other than that, I like the slower pace puzzle feel. Some of the path finding made me feel like I didn't have a say in the move at all, but overall pretty good.
Very funny, very enjoyable game. The only thing I didn't like was not getting to see the room of evil. ;)
I kept making very little progress, then getting stuck in walls. The game's main innovation was the color change, which would have helped me maintain a better idea of where I was if I didn't keep getting jammed into a wall. I gave up after the third time, stuck somewhere in green. :P
I found that the controls were very "sticky," to the point of being frustrating. This was a new level of sticky; 25% of the time, the player wouldn't even move while holding a button, which made beating it not even seem worth it, especially when you have to restart every time you're hit.
Try using bounding box collisions rather than pixel-perfect ones. Also, yes, the random level generator produces 75% unbeatable levels.
I should stress that he probably means "Gem tracker" as in "thing that tells you what gems you have" rather than "thing which tells you where gems are located." Most of the game's challenge is wandering around lost in the dark without a purpose. The rest of the challenge is the horrible collisions and rope physics due to not having quite as much time as I hoped to implement them. Sorry.
Indeed, I was sad to see that the game was so short. The graphics are eye-catching; I love the style.
Other remarks: Fucking birds.
You certainly have that professional touch.
It is impossible to be mad at the game play, because the only person you have to be mad at is yourself for choosing the path that collided. Took me some 30 tries to beat this.
Your game is fucking freaky, man. It may be the 1:30 AM thing, but this game is damned scary.
The concept is somewhat innovative. As you said, there wasn't enough visual feedback, and as has been said, the jumps and collisions are kind of frustrating. I am wondering if I've missed a wallkick or double jump mechanism, because it's easy to get stuck and screw yourself.
Points for fun, and points for innovation. Quite unique, just annoying in the collisions department.
My game's fucking ridiculous, too. ^_^
Points for mood, audio, and graphics. The game was kind of fun until there were so many crowds I couldn't walk 32 pixels.
Your game is fucking ridiculous.
I'm a little pissed you went and beat me. Still, great little game.
Exception in thread "main" java.lang.UnsatisfiedLinkError: no lwjgl in java.library.path
at java.lang.ClassLoader.loadLibrary(ClassLoader.java:1681)
at java.lang.Runtime.loadLibrary0(Runtime.java:840)
at java.lang.System.loadLibrary(System.java:1047)
at org.lwjgl.Sys$1.run(Sys.java:73)
at java.security.AccessController.doPrivileged(Native Method)
at org.lwjgl.Sys.doLoadLibrary(Sys.java:66)
at org.lwjgl.Sys.loadLibrary(Sys.java:95)
at org.lwjgl.Sys.<clinit>(Sys.java:112)
at org.lwjgl.opengl.Display.<clinit>(Display.java:135)
at nl.sonware.alone.Alone.start(Alone.java:44)
at nl.sonware.alone.Alone.main(Alone.java:116)
The first line of the Mac shell script is all you need to run it on Linux.
java -jar -Djava.library.path=./native/ Alone.jar
Nice game. I don't understand why your friend goes insane and tries to kill you, but whatever. The graphics were nice, the engine was a bit odd but capable.
The audio is badly broken; play the no audio version if it gets stuck loading for you.
I gotta say, the dynamics are good, the collisions are good, the idea is good, but the controls are awful. A and D usually strafe, so you can keep aiming at what you're shooting at. Instead, I get eaten 10% of the time, which would be fine except you have to start all over. Overall, good game.
Fails to run in WINE, unfortunately. Looked pretty cool.
Reminds me vaguely of circle the cat. Kind of fun until you win a few times.
Nice game! The graphics all fit well together, the story's rather amusing; I like it. The spike collisions could be a bit more lenient. Other than that, I quite liked it.
By the way: When I play the web version, all that happens is the elderly man drops off the screen. And my browser lags.
The game lagged so much I didn't want to continue, unfortunately. Didn't hear any audio, but the graphics were great. I keep seeing all these games with powerups and abilities rather than actual evolution... sort of a pity. Engine was pretty solid, but the ability to slow down while jumping is a must.
Great graphics, great introductory sequence, good puzzles. Funny use of unicorns. I didn't hear any sound; apparently that's some sort of glitch as they are mentioned in comments and in your description.
I can't run unity from the web, but I can through WINE if you build it for Windows.
A bit short, but the idea was there. It was very simple to figure everything out; a couple games with similar dynamics (ie, evolved abilities) benefited more from their perplexing level design than their graphics. Still, neat game.
What the first guy said.
Fun, kind of funny game. It's amazing how simple graphics can look so elegant and endearing; they really looked nice together. Steep learning curve; after I figured out that I could aim upwards, the game became unlosable. Which was fine, because after like 30 waves, I could afford everything all at once, and so next round I went all Keanu-Reeves-Kitty on everyone. I'd let them all gang up on me, then BOEM, I go flying and they're all dead.
Quite enjoyed this game; wish there was a conclusion, because I ended up with nearly a hundred "children" and just wanted to be done.
Points for theme and innovation. Very clever. Real bacteria, though, have DNA much more similar; two randomly selected bacteria from the population have DNA that's nothing alike, which makes the game very hard, especially for people like me who have no musical talent. It'd be nice to win once in a while, is all I'm saying. ;)
I suppose this means you can't just build for other platforms?
Could you upload just a zip of the game contents? I'd rather not install it, especially through WINE.
Intro is amazing. Sound is great for LD, graphics are really good. Gameplay is frustrating; five health that never recovers, and insufficient funds to even begin generating funds make it a pain. I don't think it's possible to attain what you show in the screenshots without cheating.
The game is addictive, so extra points for fun. Did finally beat it; the trick is to put one eukaryote at the beginning, then upgrade it to a plant with more eukaryotes further down the track. The plant will generate enough energy to get you started in the time it takes for the waves to get killed off, which you can use to double or triple your offense, and upgrade your plant to get more energy.
Good graphics and audio. Freezes on level 2 loading screen and commences filling RAM, never to complete.
It's interesting how much better a texture makes simple shapes look; the graphics appear professional with the light gradient and the rough texture. Not really all that fun, but kind of interesting.
Chokes WINE. I really should scan the description for Microsoft dependencies before I try running this stuff. >_<
Can you build this for Java 6? I do not have Java 7, and it is not yet offered on my platform.
Graphics and audio are stunning. I have no idea what you did wrong with the engine, because it constantly thinks I'm holding the right key. Even when I don't touch it. It seemed to have that problem with a lot of keys, but right was the only one it would think I pressed without me ever touching it (while other keys would just stick). Probably Game Maker's fault, honestly, but it nonetheless prevented me from completing the first level with buzz saws.
Anyway, keep up with the art (graphics and music). I've never been that great at spriting, nor do I have any musical talent, and I knew very few people as good as you at it when I was 14.
As a matter of fact, your game is pretty solid for Game Maker in general; quite impressive for 48 hours. Even considering the parts of code from various contributors' repositories (eg, the text box script).
See the prior remarks on wall jump mechanics.
Other remarks: SWEET MOTHER OF GOD, THE SOURCE FILE IS A SINGLE, 170MB OBJECT. I told IsmAvatar not to preload sound data into the IDE, but nooooo, 17 months later it's still doing it. As said, don't use WAV for music. MP3 seems like your best bet, since you use GM (ours supports OGG and XM/S3M/IT), but WAV is not your friend. Also, avoid execute_string(), it's a bad habit (and it makes it so I can't compile the thing natively, which is annoying).
Not a bad shot.
Unfortunately, .NET and WINE don't agree. Screenshots are very... interesting, though.
This is the second game I've seen exclusively for Android...
I'm gonna join in complaining about how there's no feedback. I had no idea what I was doing, until it told me that I hadn't gotten far enough for them to exist. It's neat that you made it in Scratch, because my general feeling about Scratch is that it is incapable of producing a game. I like the idea, I just didn't see it in the game.
This is experimental prerelease support for the Windows platform: use at your own risk. "Your Kitten of Death awaits!"
WARNING: Error calling finalizer #<CLOSURE (LAMBDA # :IN INITIALIZE-INSTANCE)
{22981085}>: #<SIMPLE-ERROR "EXCEPTION_ACCESS_VIOLATION" {24B6F3F1}>
VirtualAlloc: 0x1e7.
fatal error encountered in SBCL pid 55: handle_exception: VirtualAlloc failure
Welcome to LDB, a low-level debugger for the Lisp runtime environment.
Space to evolve into a random animal doesn't fit the theme very well, but it is pretty funny.
Still not working on Linux, I'm afraid. Other people have gotten LWJGL games working great with a shell script; you might want to invest in that ;)
Try as I might, I can't beat this game. It just takes too many tries to get each jump right, and I keep falling through the floor. Seems to be a good number of levels. Wish I could see the ending. Overall, great work; just need more boost than the flamethrower actually gives to get through the level.
I went back and, with some struggle, managed to beat it. Great game; the length makes it. A little more tolerance on the jumps would be good, but more than that, next time, limit your vertical speed; don't let it pass the height of a block (or if you do, test collisions manually instead of leaving it to Construct, whose collisions are apparently as bad as Game Maker's).
Impossible to lose, really; levels don't get any harder. Took me a while to realize they just go on to infinity. Still, procedural generation is neat. Graphics are lovely. Nicely done.
Biggest peeve from this game is the random spawn; sometimes I spawn in the middle of 1,000 enemies, sometimes I spawn outside the level. Cleared the whole game (assuming there's no hidden exit to level five), wish there were an ending screen. I'd take an ending screen over a title screen with a "play" button any day.
Very solid engine for HTML5, but the down slopes need work (can't jump on them while moving down). Great audio, great graphics, but I'm afraid there wasn't much else to this game at this point. Do continue it; it seems to be a nice foundation.
I'm going to assume I'm not supposed to start out with no weapons and no ability to mine in the middle of a barrage of enemies I can't defend against.
main.py:316: SyntaxWarning: name 'objects' is used prior to global declaration
global objects
main.py:359: SyntaxWarning: name 'score' is assigned to before global declaration
Very, very nice. Could have told me this was a Jam game and I'd believe you. The sounds, music, graphics... The graphics were very simple, yet being vector graphics/basic shapes made it look quite elegant. Plus, the motion and framerate were very smooth, which is a rarity in Ludum Dare games. Game play was nice, and mostly balanced; if anything, it was a bit too easy. Only complaint is that the sound sometimes got really loud as multiple sources played over each other. Great game, over all.
WINE doesn't like it, apparently. Maybe because it's 64 bit?
Full points for Innovation, Theme, and Graphics. Very creative; nice to see a game that actually came up with a creative twist on the theme.
If anyone wants the best string I came up with, it is this:
agggacttagctaggtttaaatgcgaacctaatcat
I can't tell if there are any more useful strands or not.
Also, yeah, kind of annoying entering them manually. Maybe with a keyboard, or clipboard function?
Anyway, nicely done.
I got one of the beaver endings. I appreciated the unicorn and zombie endings. ;)
It was a fun game with great graphics, a solid engine, and decent audio, but literally nothing changed or evolved. There was just nothing new or theme-related here. Still, nice game, decently fun; I won't hold the theme against the overall category.
Great music, great graphics. Balance is all off. I spend $200 on blasters up front, and don't spend anything else, saving up for missiles before getting wiped out by the hyper-advanced weapons of the "evolved" enemies. Level one, I'm losing because everyone but me has a deflector.
Unity...
Is it just me, or has the number of XNA games tripled this time? I can't play these in WINE, unfortunately.
Fantastically done; your ideas were brilliantly creative. The raphics all worked well together, with exception of that one boulder sprite. The puzzles were great. Engine was mostly solid; a couple collision bugs made apparent in the portal reference. Remember to limit your vertical speed. Overall, very well done.
Could you build this with Java 6? My OS doesn't offer Java 7, or vice-versa.
Very cool. Good music. Graphics weren't great, but they worked. Very unique idea; quite fun. Controls and jump heights could have used explanation.
This game is much more fun than it really ought to be. You're one of the few who took the theme to heart and really sewed in the evolution aspect. That said, you're one of the many who don't know how to say, "You Win!" I bred an invincible super-army for size, and played to level 32 before realizing there was no winning. By that point, my army was bigger than the screen, and the enemy died nearly instantly. But I still didn't win.
Still, great use of theme. Good game.
Big fan of the idea. Implementation was a bit of a pain in the ass, but, meh, I like it anyway.
Okay, really, this is the third Java 7 game I've seen. Why can't people just use Java 6 for a bit longer while 7 spreads?
Can't run because WINE can't put things in the MATE system tray. Don't know why this needs an icon in my tray, but...
Collisions are wildly annoying. Graphics are a little hodgepodge, but I like the background texture. Theme's okay, a bit too historic for my tastes, but I'll count it. Audio's really loud.
Makes WINE explode. =\
The game could use some balance; after about 1000 health, the game becomes unlosable. I ended up having over 100,000,000 life. It was also very predictable; enemy types and boss scenes were random, but everything else was mathematically modeled and not well balanced.
In spite of that, the game was still fun, and quite addictive. How bad can it be if it kept me playing until I had stats that high?
Failed to start.
Exception in thread "main" java.lang.reflect.InvocationTargetException
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
at java.lang.reflect.Method.invoke(Method.java:616)
at org.eclipse.jdt.internal.jarinjarloader.JarRsrcLoader.main(JarRsrcLoader.java:58)
Caused by: java.lang.Error: Unresolved compilation problems:
g cannot be resolved to a variable
Syntax error, insert "}" to complete Block
at pixels.ac.<init>(ac.java:25)
at pixels.ab.<init>(ab.java:11)
at pixels.aa.main(aa.java:11)
XNA/family choke WINE.
It seems a lot of work went into the graphics and audio. The collisions could use work; snagging on the bottom corner of a wall as you move diagonally is annoying. Overall I like the idea, though the theme was very loosely tied in, in my opinion.
Fascinating; first ncurses game I've ever played from Ludum Dare. A bit hard to follow, though, and there's a huge curve between the fourth and fifth bosses. Either way, not bad.
Can you build this natively? WINE can't help me run Unity in a browser.
Yeah, XNA and WINE don't get along, either.
Can you build a Windows binary? WINE won't help me run this in the browser.
I like the idea, but you didn't give it nearly enough room to take effect. Three generations isn't a whole lot of time for moths to evolve; I don't think I'd have centered the game around the idea without tripling the number of rooms.
The enemies "adapted" to spawning at the bottom of the screen where I can't hurt them without getting hurt. Still kind of neat; just not the challenge I was looking for.
I must be at the bottom of the bucket, because all the games I've clicked today have been XNA, and I can't run them.
Controls? I see you click to push particles. My goal is to make everything pink by some magic, without an understanding of what is happening. Pushing them together did nothing; all I was seeing was a number near thirty fluctuate within 1%.
Game looks really good; no one around here does XNA, though.
Very polished; felt nothing like it had been made in 48 hours. My only complaint is that it was surprisingly short; it seems like you had everything down very well, and I was expecting to have a level wherein the switch-instead-of-push dynamic really became part of the puzzle. Either way, very nicely done.
Sudden audio scared the hell out of me. Probably because it's late. Anyway, I had no idea what I was doing, but it looked really cool, doing it.
XNA and WINE just don't agree; an installer won't help.
I laughed when that 800 pound pink dodo showed up. Great little game; great graphics, funny and well-thought theme. Really liked it.
I like your art style, and the idea is neat, but I am not personally a fan of this kind of game in general. The objection screen was funny. Audio was good, too.
I died 14 times; 11 were due to the jump bug, 2 were due to the lack of delay between respawn and death. One was because the enemies actually contacted me. I liked the theme; evolution of video games. The dialog was a bit cheesy, but overall nice.
It says "Press enter to continue", but Enter doesn't do anything.
WINE doesn't like XNA at all, so my list is pretty much nothing but XNA games I can't run, at this point.
Unhandled Exception: System.TypeLoadException: Could not load type 'GB2Dsample.Game1' from assembly 'The Darwinizer, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null'.
Am I missing something?
Actually, you're right; that exception was from another game I had attempted to run in the same terminal. The error with your game was apparently a WINE problem; I just copied the first error text I saw.
If anyone would like a 32-bit Linux build, let me know and I'll arrange for one. I figure Linux users have mostly 'evolved' by now. ;)
The massive amounts of blood is a glitch that I noticed some half hour before the comptetition was over, and it was basically too late to do anything about it. I'm not really sure what's happening, other than that having fifty flames in one spot leads to fifty death scenes due to fifty collisions, but it's odd because the first one should destroy the enemy, preventing further collision events from firing.
It probably wouldn't take all that long to fix, but no, it's definitely a glitch. :P
Thanks for the comments, everyone!
@mdkess
Thanks for the heads up. I thought the ALURE library shipped with Linux. I'd have linked it statically if I knew it would be a dependency. I'm not sure what exactly I would include in the zip, save for libalure.so, but it's my understanding Linux doesn't check the working directory for shared libraries...
@Fruitifly Not sure what you mean; the character faces the mouse.
Hm. It is possible that they randomly evolve a really good strain right up front; I get very mixed reviews about how easy the enemies are. I suppose that if there is ever a next time I attempt to use a genetic algorithm in the game, I will have to put less weight on attack codes in the RNG. :P
Anyway, I'm glad you both beat it; sorry to hear that you did not, mohammad.
I installed everything libjpeg-related that was available, but this still won't run for me on Ubuntu 12.04. I have the development packages, too.
Great puzzle idea, and awesome graphics to boot. If you try hard enough, you can walk through walls. Took me a while to figure out what was going on, but I found it quite fun once I did. Beat it twice.
I've never had a good experience with XNA. And WINE doesn't like XNA at all, so my list is pretty much nothing but XNA games I can't run, at this point.
Not seeing any evolution whatsoever, but since I don't see any rules that disqualify games that don't follow themes, so I'll still rate it. The kittens are annoying; had I not beaten level ten on the first try I'd have given up. Also, the bridges don't work. That aside, the game mechanics were pretty fun and interesting.
XNA games don't agree with WINE.
So this is the umpteenth bottom-of-my-barrel game I can't play because it needs XNA, and WINE doesn't do XNA. Screenshots were very alluring to me, too.
The controls were annoying, but I like the concept. Not all that evolution-y, but still better than the run-of-the-mill "collect powerups!" games I've been seeing. My only real complaint with the controls are that it resets your position each time; I want to be just a few pixels away from where I dropped last time, for massive damage.
Yeah, I lack WINE64, so I can't play this either.
I like the framerate. Unique for browser games. The rate at which one enemy could kill you was somewhat ridiculous, but the length of the game made up for it to a degree. Parts of it were very frustrating. Lots of points for humor; the mustache made it. The theme was very loosely tied in, though.