FoonLudum Dare ExplorerLD24 → Dragoneticist

Dragoneticist

By gidaio

View on Wayback Machine

CategoryRankScoreCount
Coolness369
Theme343.59
Innovation383.50
Humor573.04
Overall1203.12
Fun1302.88
Mood1692.50
Audio2041.53
Graphics2172.44

Comments

gidaio 2012-08-28 01:07

Oh yeah. The other members of the team are Bowlercaptain and TNR7. Looking forward to doing this again.

devwouter 2012-08-28 18:25

Could have used a clipboard on which we could store the genes. I'm quite certain I didn't type it over correctly.

kayelgee 2012-08-28 18:37

I really like the dna maipulate feature
it would help if the discovered combinations would show up at the dna screen and the characters should be right above every base, because it's hard to see which base I am modifying if I have to look to the top like it is now

bobiniki 2012-08-28 18:52

I think i got all the codes but I cant defeat the boss :(
I like the idea how you modify your dragon trough the DNA structure. I really want to see this become a finished game(more content better graphics, animations,more customization)
Also what is the difference between the 3 types of attack?
Overall a good game!

kevincorrigan 2012-08-28 18:54

Nice concept, I enjoyed trying to find out the dna sequences that did stuff, Good job.

gidaio 2012-08-28 19:27

@bobiniki If you're really having trouble, here's a secret: the table floating out in the blackness right before Alex is actually a secret passage where you can modify Alex's Dragon's DNA code and make it suck.

@Kayelgee That was the original plan. Actually, the original plan was to have the characters show you the DNA sequences in a color format, so it would be easy and intuitive. Unfortunately, as is extremely common, we ran out of time... :/

oceanspud 2012-08-28 20:01

I fought the big boss Alex.. as soon as it started he jumped off into the sky and died... Anti-climatic :P

gidaio 2012-08-28 23:23

Yeah, it's surprising how difficult it is to program a platforming AI that can adapt to different physics and doesn't use a pathfinding algorithm.

chuchino 2012-08-28 23:59

Definitely lacks polish, but it's cute and fun. The DNA modification mechanic was cool, even though the interface for it was awkward. I didn't find the secret passage, so I was only able to beat the final boss by standing far away and hitting it with long-range fire breath a ton of times.

panzermancer 2012-08-29 03:23

Yeah, there was no explanation as to how changing a dragon's genes actually worked. It's a shame, because the concept seems really, really cool.

I just ran through the whole game with the basic dragon. When I fought the final dragon, it immediately jumped so high it went off-screen and died, leaving me the victor. Hilarious as that may have been, I'm sure that wasn't intentional.

It was a cool idea, though. Good effort, but better luck next time!

kumquat 2012-08-29 17:33

The genetic manipulation is really a great mechanic. I also like the pokemon style, it's a little bit nostalgic.
It will be nicer if it has a tutorial and maybe a book to save the DNA combinations. It was difficult to figure out most of the stuff in the beginning.
There was a bug with the last boss, it just flew away and all of a sudden I won LOL

imef 2012-08-29 20:57

I actually really liked that!

PS : I found a bug! If you move sideways getting out of a room, you end up behind in the dark area! ;)

zatyka 2012-08-30 01:31

Cool concept, but definitely incomplete. Please continue with this as I think it has TONS of potential.

jovoc 2012-08-30 06:06

Really liked this concept. And this felt like a ton of gameplay given the time limits. nice work.

nddrylliog 2012-08-30 15:03

Had lots of fun! Like a Pokemon/Zelda mix, but dragon-themed. Had to admit I never noted down DNA chains to use them later, but instead I just swapped genes randomly to see what my dragon could do.

Got beaten down twice by THE ULTIMATE DRAGON though. Nice work!

demonpants 2012-08-30 17:41

Mac version please thanks!

gidaio 2012-08-30 17:57

@demonpants No can do. :/ Sorry, but none of us own a mac, and currently, the only way to get this game on a Mac would be to buy the hundred-dollar GM Studio.

whilefun 2012-08-31 01:51

Pretty cool. I really liked the DNA strand animation! The best part of this is your description - "BUT IT'S AWESOME THAT WE DID THIS, EVEN IF IT SUCKS.". That's the key right there. Can't wait to see what your future entries are like! :)

capgrip 2012-09-01 02:02

Simple and fun. Change DNA is a great feature, I really like it. Well done!

josh-dreamland 2012-09-07 14:41

Full points for Innovation, Theme, and Graphics. Very creative; nice to see a game that actually came up with a creative twist on the theme.

If anyone wants the best string I came up with, it is this:
agggacttagctaggtttaaatgcgaacctaatcat

I can't tell if there are any more useful strands or not.

Also, yeah, kind of annoying entering them manually. Maybe with a keyboard, or clipboard function?
Anyway, nicely done.

creative630 2012-09-12 13:25

The combat didn't really make me very excited but the DNA manipulation to find interesting enhancements was amazing. Good job.

tcstyle 2012-09-13 19:27

Nice idea. A little confusing.