Foon → Ludum Dare Explorer → LD24 → Feedback comment stats → Josh @ Dreamland
Feedback comments for LD24
Josh @ Dreamland's games and stats for all events →
| Timestamp | Since previous | Game | Josh @ Dreamland's comment |
|---|---|---|---|
| Aug 27 14:36:00 | Caveman Evolution Story | Nice game! The graphics all fit well together, the story's rather amusing; I like it. The spike collisions could be a bit more lenient. Other than that, I quite liked it. <br/> <br/>By the way: When I play the web version, all that happens is the elderly man drops off the screen. And my browser lags. | |
| Aug 30 21:47:00 | 79h 11m | Go Darwin | I laughed when that 800 pound pink dodo showed up. Great little game; great graphics, funny and well-thought theme. Really liked it. |
| Aug 30 23:04:00 | 1h 17m | Evoship | The game could use some balance; after about 1000 health, the game becomes unlosable. I ended up having over 100,000,000 life. It was also very predictable; enemy types and boss scenes were random, but everything else was mathematically modeled and not well balanced. <br/> <br/>In spite of that, the game was still fun, and quite addictive. How bad can it be if it kept me playing until I had stats that high? |
| Aug 30 23:14:00 | 10m 00s | Passive | It seems a lot of work went into the graphics and audio. The collisions could use work; snagging on the bottom corner of a wall as you move diagonally is annoying. Overall I like the idea, though the theme was very loosely tied in, in my opinion. |
| Aug 30 23:19:00 | 5m 00s | Lepidopter Attack | I like the idea, but you didn't give it nearly enough room to take effect. Three generations isn't a whole lot of time for moths to evolve; I don't think I'd have centered the game around the idea without tripling the number of rooms. |
| Aug 30 23:25:00 | 6m 00s | Involucion | Can you build this for Java 6? I do not have Java 7, and it is not yet offered on my platform. |
| Aug 31 01:53:00 | 2h 28m | OS: Evolution | Try as I might, I can't beat this game. It just takes too many tries to get each jump right, and I keep falling through the floor. Seems to be a good number of levels. Wish I could see the ending. Overall, great work; just need more boost than the flamethrower actually gives to get through the level. |
| Aug 31 01:54:00 | 1m 00s | EvolutionaryWeapon | Game looks really good; no one around here does XNA, though. |
| Aug 31 02:18:00 | 24m 00s | Evowing | Great music, great graphics. Balance is all off. I spend $200 on blasters up front, and don't spend anything else, saving up for missiles before getting wiped out by the hyper-advanced weapons of the "evolved" enemies. Level one, I'm losing because everyone but me has a deflector. |
| Aug 31 02:53:00 | 35m 00s | Darwin's Ghost vs. Science | Very polished; felt nothing like it had been made in 48 hours. My only complaint is that it was surprisingly short; it seems like you had everything down very well, and I was expecting to have a level wherein the switch-instead-of-push dynamic really became part of the puzzle. Either way, very nicely done. |
| Aug 31 03:12:00 | 19m 00s | kinetic dream | Very, very nice. Could have told me this was a Jam game and I'd believe you. The sounds, music, graphics... The graphics were very simple, yet being vector graphics/basic shapes made it look quite elegant. Plus, the motion and framerate were very smooth, which is a rarity in Ludum Dare games. Game play was nice, and mostly balanced; if anything, it was a bit too easy. Only complaint is that the sound sometimes got really loud as multiple sources played over each other. Great game, over all. |
| Aug 31 03:17:00 | 5m 00s | Monkeyectomy | It says "Press enter to continue", but Enter doesn't do anything. |
| Aug 31 06:00:00 | 2h 43m | Evo | Great graphics, great introductory sequence, good puzzles. Funny use of unicorns. I didn't hear any sound; apparently that's some sort of glitch as they are mentioned in comments and in your description. |
| Aug 31 14:56:00 | 8h 56m | Shit! It's evolving | The audio is badly broken; play the no audio version if it gets stuck loading for you. <br/> <br/>I gotta say, the dynamics are good, the collisions are good, the idea is good, but the controls are awful. A and D usually strafe, so you can keep aiming at what you're shooting at. Instead, I get eaten 10% of the time, which would be fine except you have to start all over. Overall, good game. |
| Aug 31 21:03:00 | 6h 07m | Game Time Evolution | I died 14 times; 11 were due to the jump bug, 2 were due to the lack of delay between respawn and death. One was because the enemies actually contacted me. I liked the theme; evolution of video games. The dialog was a bit cheesy, but overall nice. |
| Aug 31 21:44:00 | 41m 00s | Lab Experiment Demo | Fantastically done; your ideas were brilliantly creative. The raphics all worked well together, with exception of that one boulder sprite. The puzzles were great. Engine was mostly solid; a couple collision bugs made apparent in the portal reference. Remember to limit your vertical speed. Overall, very well done. |
| Aug 31 23:52:00 | 2h 08m | Pasazh | Ran fine from Ubuntu. Can hardly believe this was made in two days. Fantastic graphics and level design; that alone would have taken me more than 48 hours. Music was nice. My score on the first round was 167; killed everything, but missed two crystals. |
| Sep 1 00:13:00 | 21m 00s | Ascension Garden | Big fan of the idea. Implementation was a bit of a pain in the ass, but, meh, I like it anyway. |
| Sep 1 14:06:00 | 13h 53m | "Natural" Selection | The enemies "adapted" to spawning at the bottom of the screen where I can't hurt them without getting hurt. Still kind of neat; just not the challenge I was looking for. |
| Sep 1 14:13:00 | 7m 00s | Tonality | Points for theme and innovation. Very clever. Real bacteria, though, have DNA much more similar; two randomly selected bacteria from the population have DNA that's nothing alike, which makes the game very hard, especially for people like me who have no musical talent. It'd be nice to win once in a while, is all I'm saying. ;) |
| Sep 1 15:23:00 | 1h 10m | A scientific experiment | Fun, kind of funny game. It's amazing how simple graphics can look so elegant and endearing; they really looked nice together. Steep learning curve; after I figured out that I could aim upwards, the game became unlosable. Which was fine, because after like 30 waves, I could afford everything all at once, and so next round I went all Keanu-Reeves-Kitty on everyone. I'd let them all gang up on me, then BOEM, I go flying and they're all dead. <br/>Quite enjoyed this game; wish there was a conclusion, because I ended up with nearly a hundred "children" and just wanted to be done. |
| Sep 1 19:59:00 | 4h 36m | Vesuvius | ....... |
| Sep 1 20:01:00 | 2m 00s | Infestation | Unity... |
| Sep 1 20:07:00 | 6m 00s | Natural Selection: Travel Agency | Fails to run in WINE, unfortunately. Looked pretty cool. |
| Sep 1 20:30:00 | 23m 00s | Stadium of the Kernel | Fascinating; first ncurses game I've ever played from Ludum Dare. A bit hard to follow, though, and there's a huge curve between the fourth and fifth bosses. Either way, not bad. |
| Sep 1 20:38:00 | 8m 00s | Evolution game | Unfortunately, .NET and WINE don't agree. Screenshots are very... interesting, though. |
| Sep 1 20:39:00 | 1m 00s | .Evolvorous. | Could you upload just a zip of the game contents? I'd rather not install it, especially through WINE. |
| Sep 1 20:59:00 | 20m 00s | SPECIES | I like the framerate. Unique for browser games. The rate at which one enemy could kill you was somewhat ridiculous, but the length of the game made up for it to a degree. Parts of it were very frustrating. Lots of points for humor; the mustache made it. The theme was very loosely tied in, though. |
| Sep 1 21:01:00 | 2m 00s | The Darwinizer | XNA games don't agree with WINE. |
| Sep 1 21:03:00 | 2m 00s | Cannibal Slugmage of Eden | This is experimental prerelease support for the Windows platform: use at your own risk. "Your Kitten of Death awaits!" <br/>WARNING: Error calling finalizer #<CLOSURE (LAMBDA # :IN INITIALIZE-INSTANCE) <br/>{22981085}>: #<SIMPLE-ERROR "EXCEPTION_ACCESS_VIOLATION" {24B6F3F1}> <br/>VirtualAlloc: 0x1e7. <br/>fatal error encountered in SBCL pid 55: handle_exception: VirtualAlloc failure <br/> <br/>Welcome to LDB, a low-level debugger for the Lisp runtime environment. |
| Sep 1 21:06:00 | 3m 00s | Plan M | My monitor doesn't support the resolution your game tries to impose. Or if it tries a number of resolutions, WINE just doesn't agree with it. |
| Sep 1 21:09:00 | 3m 00s | Dragonkin EVO | Unhandled Exception: System.TypeLoadException: Could not load type 'GB2Dsample.Game1' from assembly 'The Darwinizer, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null'. <br/>Am I missing something? |
| Sep 1 21:12:00 | 3m 00s | The Amazing Adventure of Magenta-Man | Makes WINE explode. =\ |
| Sep 1 22:10:00 | 58m 00s | EvoCube: Epoch Victorious | Great puzzle idea, and awesome graphics to boot. If you try hard enough, you can walk through walls. Took me a while to figure out what was going on, but I found it quite fun once I did. Beat it twice. |
| Sep 1 22:12:00 | 2m 00s | Aggrandize | I suppose this means you can't just build for other platforms? |
| Sep 1 22:18:00 | 6m 00s | Eludare Virus | It's interesting how much better a texture makes simple shapes look; the graphics appear professional with the light gradient and the rough texture. Not really all that fun, but kind of interesting. |
| Sep 1 22:22:00 | 4m 00s | Evolution Jumper | Chokes WINE. I really should scan the description for Microsoft dependencies before I try running this stuff. >_< |
| Sep 2 04:31:00 | 6h 09m | The Fromagist | I got one of the beaver endings. I appreciated the unicorn and zombie endings. ;) |
| Sep 2 04:42:00 | 11m 00s | Squishy's escape | A bit short, but the idea was there. It was very simple to figure everything out; a couple games with similar dynamics (ie, evolved abilities) benefited more from their perplexing level design than their graphics. Still, neat game. |
| Sep 2 05:42:00 | 1h 00m | Unstable Planet | Impossible to lose, really; levels don't get any harder. Took me a while to realize they just go on to infinity. Still, procedural generation is neat. Graphics are lovely. Nicely done. |
| Sep 2 15:34:00 | 9h 52m | Monkey Trial Turnaround | I like your art style, and the idea is neat, but I am not personally a fan of this kind of game in general. The objection screen was funny. Audio was good, too. |
| Sep 7 02:43:00 | 107h 09m | Monsieur Evolution | I can't run unity from the web, but I can through WINE if you build it for Windows. |
| Sep 7 02:50:00 | 7m 00s | Out of the Sea | Space to evolve into a random animal doesn't fit the theme very well, but it is pretty funny. |
| Sep 7 02:51:00 | 1m 00s | Temporal Agent | This is the second game I've seen exclusively for Android... |
| Sep 7 03:00:00 | 9m 00s | Survival of the Fittest | Very solid engine for HTML5, but the down slopes need work (can't jump on them while moving down). Great audio, great graphics, but I'm afraid there wasn't much else to this game at this point. Do continue it; it seems to be a nice foundation. |
| Sep 7 03:03:00 | 3m 00s | Vegetal Evolution | Still not working on Linux, I'm afraid. Other people have gotten LWJGL games working great with a shell script; you might want to invest in that ;) |
| Sep 7 03:27:00 | 24m 00s | Growth | Biggest peeve from this game is the random spawn; sometimes I spawn in the middle of 1,000 enemies, sometimes I spawn outside the level. Cleared the whole game (assuming there's no hidden exit to level five), wish there were an ending screen. I'd take an ending screen over a title screen with a "play" button any day. |
| Sep 7 03:36:00 | 9m 00s | T.R.E.E. | I'm going to assume I'm not supposed to start out with no weapons and no ability to mine in the middle of a barrage of enemies I can't defend against. |
| Sep 7 03:40:00 | 4m 00s | Garbage Man: Return to Earth [HD] | WINE doesn't like it, apparently. Maybe because it's 64 bit? |
| Sep 7 03:53:00 | 13m 00s | Untitled Tower Game | The game lagged so much I didn't want to continue, unfortunately. Didn't hear any audio, but the graphics were great. I keep seeing all these games with powerups and abilities rather than actual evolution... sort of a pity. Engine was pretty solid, but the ability to slow down while jumping is a must. |
| Sep 7 13:41:00 | 9h 48m | Glider Drop | The controls were annoying, but I like the concept. Not all that evolution-y, but still better than the run-of-the-mill "collect powerups!" games I've been seeing. My only real complaint with the controls are that it resets your position each time; I want to be just a few pixels away from where I dropped last time, for massive damage. |
| Sep 7 13:48:00 | 7m 00s | Digital Evolution by TheJackiMonster | It was a fun game with great graphics, a solid engine, and decent audio, but literally nothing changed or evolved. There was just nothing new or theme-related here. Still, nice game, decently fun; I won't hold the theme against the overall category. |
| Sep 7 14:41:00 | 53m 00s | Dragoneticist | Full points for Innovation, Theme, and Graphics. Very creative; nice to see a game that actually came up with a creative twist on the theme. <br/> <br/>If anyone wants the best string I came up with, it is this: <br/>agggacttagctaggtttaaatgcgaacctaatcat <br/> <br/>I can't tell if there are any more useful strands or not. <br/> <br/>Also, yeah, kind of annoying entering them manually. Maybe with a keyboard, or clipboard function? <br/>Anyway, nicely done. |
| Sep 7 17:00:00 | 2h 19m | Cellulae | XNA never agrees with WINE... |
| Sep 7 17:01:00 | 1m 00s | A Caveman Goes to Space! | Is it just me, or has the number of XNA games tripled this time? I can't play these in WINE, unfortunately. |
| Sep 7 17:02:00 | 1m 00s | The Room | Any chance of a Linux build? |
| Sep 7 17:10:00 | 8m 00s | Far From Earth | Could you build this with Java 6? My OS doesn't offer Java 7, or vice-versa. |
| Sep 7 18:08:00 | 58m 00s | RGB Evolution | This game is much more fun than it really ought to be. You're one of the few who took the theme to heart and really sewed in the evolution aspect. That said, you're one of the many who don't know how to say, "You Win!" I bred an invincible super-army for size, and played to level 32 before realizing there was no winning. By that point, my army was bigger than the screen, and the enemy died nearly instantly. But I still didn't win. <br/> <br/>Still, great use of theme. Good game. |
| Sep 7 18:49:00 | 41m 00s | Missing Links | Collisions are wildly annoying. Graphics are a little hodgepodge, but I like the background texture. Theme's okay, a bit too historic for my tastes, but I'll count it. Audio's really loud. |
| Sep 7 20:26:00 | 1h 37m | Bomb the Bunnies | Reminds me vaguely of circle the cat. Kind of fun until you win a few times. |
| Sep 7 20:28:00 | 2m 00s | Shapelution | Okay, really, this is the third Java 7 game I've seen. Why can't people just use Java 6 for a bit longer while 7 spreads? |
| Sep 7 20:30:00 | 2m 00s | An Astronomical Affray | Can't run because WINE can't put things in the MATE system tray. Don't know why this needs an icon in my tray, but... |
| Sep 7 20:34:00 | 4m 00s | Neurochronic Alien Fighter: Evolution! | main.py:316: SyntaxWarning: name 'objects' is used prior to global declaration <br/> global objects <br/>main.py:359: SyntaxWarning: name 'score' is assigned to before global declaration |
| Sep 7 21:22:00 | 48m 00s | Dorobou Neko! | Not seeing any evolution whatsoever, but since I don't see any rules that disqualify games that don't follow themes, so I'll still rate it. The kittens are annoying; had I not beaten level ten on the first try I'd have given up. Also, the bridges don't work. That aside, the game mechanics were pretty fun and interesting. |
| Sep 7 21:50:00 | 28m 00s | eukaryotic. | Intro is amazing. Sound is great for LD, graphics are really good. Gameplay is frustrating; five health that never recovers, and insufficient funds to even begin generating funds make it a pain. I don't think it's possible to attain what you show in the screenshots without cheating. |
| Sep 8 13:47:00 | 15h 57m | EvoBlob | Unfortunately, the game makes WINE explode. Re-scanning the description, I realize it's because it's XNA. |
| Sep 8 14:00:00 | 13m 00s | You Made them! | I'm gonna join in complaining about how there's no feedback. I had no idea what I was doing, until it told me that I hadn't gotten far enough for them to exist. It's neat that you made it in Scratch, because my general feeling about Scratch is that it is incapable of producing a game. I like the idea, I just didn't see it in the game. |
| Sep 8 17:00:00 | 3h 00m | Primordial Guard | XNA/family choke WINE. |
| Sep 8 17:19:00 | 19m 00s | Pixels through time | Failed to start. <br/> <br/>Exception in thread "main" java.lang.reflect.InvocationTargetException <br/> at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) <br/> at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57) <br/> at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43) <br/> at java.lang.reflect.Method.invoke(Method.java:616) <br/> at org.eclipse.jdt.internal.jarinjarloader.JarRsrcLoader.main(JarRsrcLoader.java:58) <br/>Caused by: java.lang.Error: Unresolved compilation problems: <br/> g cannot be resolved to a variable <br/> Syntax error, insert "}" to complete Block <br/> <br/> at pixels.ac.<init>(ac.java:25) <br/> at pixels.ab.<init>(ab.java:11) <br/> at pixels.aa.main(aa.java:11) |
| Sep 8 17:56:00 | 37m 00s | On the Origin of Block | Very cool. Good music. Graphics weren't great, but they worked. Very unique idea; quite fun. Controls and jump heights could have used explanation. |
| Sep 8 18:23:00 | 27m 00s | Gregor the Grogre | Can you build this natively? WINE can't help me run Unity in a browser. |
| Sep 9 04:51:00 | 10h 28m | Exvolvere | Representing four players at once without a graphical interface was a bit much. Neat idea, but it kind of fell through for me. |
| Sep 9 13:18:00 | 8h 27m | Experiment X | Yeah, XNA and WINE don't get along, either. |
| Sep 9 13:19:00 | 1m 00s | The Horrifying and Viciously Aggresive Though Strangely Susceptible To Evolution Monsters From Some Mysterious Random Tomb | I must be at the bottom of the bucket, because all the games I've clicked today have been XNA, and I can't run them. |
| Sep 9 13:50:00 | 31m 00s | DNA Soup | DNA speed reaches a point where the game plays itself, but you still lose because there's just no winning. Pretty neat idea, pretty fun. |
| Sep 9 13:56:00 | 6m 00s | #1 Bacterial Color Evolution - Bioterrorism against your browser! | Controls? I see you click to push particles. My goal is to make everything pink by some magic, without an understanding of what is happening. Pushing them together did nothing; all I was seeing was a number near thirty fluctuate within 1%. |
| Sep 9 17:16:00 | 3h 20m | Apes vs Dinosaurs: Unnatural Selection | XNA and WINE just don't agree; an installer won't help. |
| Sep 9 17:19:00 | 3m 00s | Slime Slayer | I installed everything libjpeg-related that was available, but this still won't run for me on Ubuntu 12.04. I have the development packages, too. |
| Sep 9 17:21:00 | 2m 00s | Unnatural Selection | Can you build a Windows binary? WINE won't help me run this in the browser. |
| Sep 9 17:24:00 | 3m 00s | The World of Worlds | I've never had a good experience with XNA. And WINE doesn't like XNA at all, so my list is pretty much nothing but XNA games I can't run, at this point. |
| Sep 9 17:25:00 | 1m 00s | UPix | WINE doesn't like XNA at all, so my list is pretty much nothing but XNA games I can't run, at this point. |
| Sep 9 17:25:00 | 0s | Unnatural Selection | WINE doesn't like XNA at all, so my list is pretty much nothing but XNA games I can't run, at this point. |
| Sep 10 01:35:00 | 8h 10m | Infect | So this is the umpteenth bottom-of-my-barrel game I can't play because it needs XNA, and WINE doesn't do XNA. Screenshots were very alluring to me, too. |
| Sep 10 01:37:00 | 2m 00s | The Destiny of Species | Yeah, I lack WINE64, so I can't play this either. |
| Sep 10 01:57:00 | 20m 00s | UNBOUND | Points for mood. Evolution was very subtle--a bit too artistically abstract for my taste, but the mood really helped it. Now, a question: Why did you feel the need to hijack my cursor and replace it with a pointer sixteen times as sensitive? |
| Sep 10 02:23:00 | 26m 00s | Empire of the Petri Dish | Sudden audio scared the hell out of me. Probably because it's late. Anyway, I had no idea what I was doing, but it looked really cool, doing it. |
| Sep 11 03:13:00 | 24h 50m | Kitten Evolution | Good graphics and audio. Freezes on level 2 loading screen and commences filling RAM, never to complete. |
| Sep 11 03:24:00 | 11m 00s | DNADream | Quite innovative. After a score of 5100 I had so much time left it wasn't a challenge anymore, but the concept was still neat. |
| Sep 11 03:36:00 | 12m 00s | Planet Evo | What the first guy said. |
| Sep 11 04:28:00 | 52m 00s | .ISO - Part One | Graphics and audio are stunning. I have no idea what you did wrong with the engine, because it constantly thinks I'm holding the right key. Even when I don't touch it. It seemed to have that problem with a lot of keys, but right was the only one it would think I pressed without me ever touching it (while other keys would just stick). Probably Game Maker's fault, honestly, but it nonetheless prevented me from completing the first level with buzz saws. <br/> <br/>Anyway, keep up with the art (graphics and music). I've never been that great at spriting, nor do I have any musical talent, and I knew very few people as good as you at it when I was 14. <br/> <br/>As a matter of fact, your game is pretty solid for Game Maker in general; quite impressive for 48 hours. Even considering the parts of code from various contributors' repositories (eg, the text box script). <br/> <br/>See the prior remarks on wall jump mechanics. <br/> <br/>Other remarks: SWEET MOTHER OF GOD, THE SOURCE FILE IS A SINGLE, 170MB OBJECT. I told IsmAvatar not to preload sound data into the IDE, but nooooo, 17 months later it's still doing it. As said, don't use WAV for music. MP3 seems like your best bet, since you use GM (ours supports OGG and XM/S3M/IT), but WAV is not your friend. Also, avoid execute_string(), it's a bad habit (and it makes it so I can't compile the thing natively, which is annoying). <br/> <br/>Not a bad shot. |
| Sep 11 19:45:00 | 15h 17m | HumanTECH | Pretty great. Good graphics, good audio; sets the mood well. Great length for a Ludum Dare game, and it doesn't get boring, which is the neat part. Engine's solid, and the collisions are great. Can't say that for a whole lot of games this competition. |
| Sep 12 13:17:00 | 17h 32m | Besugo | I hate it when there's no winning. <br/>It'd help if you gave controls next time. |